Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1945496
End position: 1945558
Length: 63

DNA sequence
>NC_022785, from 1945496 to 1945558 (63 bp); Streptomyces rapamycinicus NRRL 5491 CCTGGCGTCCGCCCAGCCCTCTCTTGCCTCCGCCCAGCCCGCCCTCGCGTCCGCTCAGCCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1945551-1946858	Sequence	M271_07380 - phenylacetate-CoA ligase (Protein is coded in complementary strand; from 1946858 to 1945551)