Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1941951
End position: 1941986
Length: 36

DNA sequence
>NC_022785, from 1941951 to 1941986 (36 bp); Streptomyces rapamycinicus NRRL 5491 GGCGGGGAGACAGGCGGGGAGACAGGCGGGAGGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1941450-1942019	Sequence	M271_07355 - HxlR family transcriptional regulator