Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1914025
End position: 1914072
Length: 48

DNA sequence
>NC_022785, from 1914025 to 1914072 (48 bp); Streptomyces rapamycinicus NRRL 5491 GACCTTCTCCTTGACCTGCTCCTTGATCTTCCCCTTGACCTGGTCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1913255-1914295	Sequence	M271_07250 - cyclase (Protein is coded in complementary strand; from 1914295 to 1913255)