Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1911622
End position: 1911681
Length: 60

DNA sequence
>NC_022785, from 1911622 to 1911681 (60 bp); Streptomyces rapamycinicus NRRL 5491 CGCTCCTCGCGGGACCGTTCCTCGCGCGGCCGTTCCTCACGGGACCGTTCCTCACGGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1911268-1911738	Sequence	M271_07230 - hypothetical protein (Protein is coded in complementary strand; from 1911738 to 1911268)