Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1720493
End position: 1720528
Length: 36

DNA sequence
>NC_022785, from 1720493 to 1720528 (36 bp); Streptomyces rapamycinicus NRRL 5491 CGGGGGCCTCGGGGGCCTCGGGGGCCTCGGGGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1716910-1721898	Sequence	M271_06480 - polyketide synthase (Protein is coded in complementary strand; from 1721898 to 1716910)