Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1709699
End position: 1709722
Length: 24

DNA sequence
>NC_022785, from 1709699 to 1709722 (24 bp); Streptomyces rapamycinicus NRRL 5491 CGGTGTCGGCGTCGGTCTCGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1706710-1716885	Sequence	M271_06475 - polyketide synthase (Protein is coded in complementary strand; from 1716885 to 1706710)