Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1702384
End position: 1702410
Length: 27

DNA sequence
>NC_022785, from 1702384 to 1702410 (27 bp); Streptomyces rapamycinicus NRRL 5491 GGTGGCGCCGGTGGTGCCGGTCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1700321-1706671	Sequence	M271_06470 - polyketide synthase (Protein is coded in complementary strand; from 1706671 to 1700321)