Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1614688
End position: 1614750
Length: 63

DNA sequence
>NC_022785, from 1614688 to 1614750 (63 bp); Streptomyces rapamycinicus NRRL 5491 CCGCCCGCCGCATCACCGGCACCACCGGCCGCATCACCGGCACCGCCCGCCGCGTCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1614535-1616121	Sequence	M271_06095 - peptidase (Protein is coded in complementary strand; from 1616121 to 1614535)