Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1506750
End position: 1506785
Length: 36

DNA sequence
>NC_022785, from 1506750 to 1506785 (36 bp); Streptomyces rapamycinicus NRRL 5491 CCCGCCCTCGGCCTCGGCCTCGGCCCCGGCCTCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1506130-1513488	Sequence	M271_05695 - beta-ketoacyl synthase (Protein is coded in complementary strand; from 1513488 to 1506130)