Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1495751
End position: 1495795
Length: 45

DNA sequence
>NC_022785, from 1495751 to 1495795 (45 bp); Streptomyces rapamycinicus NRRL 5491 GCCGCCGGAGCCGCCGGAGCCGCCGGAGCCGCCGGAGCCGCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1487094-1499285	Sequence	M271_05685 - beta-ketoacyl synthase (Protein is coded in complementary strand; from 1499285 to 1487094)