Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1405472
End position: 1405498
Length: 27

DNA sequence
>NC_022785, from 1405472 to 1405498 (27 bp); Streptomyces rapamycinicus NRRL 5491 GCGGTCGGTGCGGTCGGTGCGGTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1405458-1405763	Sequence	M271_05550 - hypothetical protein (Protein is coded in complementary strand; from 1405763 to 1405458)