Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1404284
End position: 1404328
Length: 45

DNA sequence
>NC_022785, from 1404284 to 1404328 (45 bp); Streptomyces rapamycinicus NRRL 5491 CGGGCGCGGCCGGGGCGTGCGCGGCCCCGGCGGGCGGGGCGGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1404070-1404612	Sequence	M271_05540 - hypothetical protein (Protein is coded in complementary strand; from 1404612 to 1404070)