Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1326966
End position: 1326989
Length: 24

DNA sequence
>NC_022785, from 1326966 to 1326989 (24 bp); Streptomyces rapamycinicus NRRL 5491 GCGTCCGTGTCCGCGACCGGGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1325130-1327271	Sequence	M271_05190 - hypothetical protein (Protein is coded in complementary strand; from 1327271 to 1325130)