Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1285851
End position: 1285883
Length: 33

DNA sequence
>NC_022785, from 1285851 to 1285883 (33 bp); Streptomyces rapamycinicus NRRL 5491 CCGCCGCCGCCTCGCCGCCTCCCGGCCGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1285559-1288369	Sequence	M271_05080 - LuxR family transcriptional regulator (Protein is coded in complementary strand; from 1288369 to 1285559)