Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1250823
End position: 1250846
Length: 24

DNA sequence
>NC_022785, from 1250823 to 1250846 (24 bp); Streptomyces rapamycinicus NRRL 5491 ATGCCGAGGCCGATGCCGATGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1249887-1251092	Sequence	M271_04950 - acyl-CoA dehydrogenase (Protein is coded in complementary strand; from 1251092 to 1249887)