Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1213254
End position: 1213301
Length: 48

DNA sequence
>NC_022785, from 1213254 to 1213301 (48 bp); Streptomyces rapamycinicus NRRL 5491 GGCCCTCGCGGGGGCCTTCGCGGCGCCCTTCGCGGGGCCCTTCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1212535-1214418	Sequence	M271_04805 - multidrug ABC transporter ATPase (Protein is coded in complementary strand; from 1214418 to 1212535)