Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1197390
End position: 1197416
Length: 27

DNA sequence
>NC_022785, from 1197390 to 1197416 (27 bp); Streptomyces rapamycinicus NRRL 5491 GAACTCGTCGCACTCGTCGGACTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1197103-1197729	Sequence	M271_04720 - hypothetical protein (Protein is coded in complementary strand; from 1197729 to 1197103)