Sequence retrieval

Genome: Streptomyces rapamycinicus NRRL 5491
Start position: 1118136
End position: 1118159
Length: 24

DNA sequence
>NC_022785, from 1118136 to 1118159 (24 bp); Streptomyces rapamycinicus NRRL 5491 CCCGGCCACGGCCCCGGACCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1114451-1118206	Sequence	M271_04645 - hypothetical protein (Protein is coded in complementary strand; from 1118206 to 1114451)