Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 92695
End position: 92730
Length: 36

DNA sequence
>NC_022659, from 92695 to 92730 (36 bp); Burkholderia pseudomallei NCTC 13179 CGCGTCGCGCGCATCGCGCGCGTCGAGCGCGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 91889-93970	Sequence	BBK_71 - response regulator (Protein is coded in complementary strand; from 93970 to 91889)