Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 686188
End position: 686211
Length: 24

DNA sequence
>NC_022659, from 686188 to 686211 (24 bp); Burkholderia pseudomallei NCTC 13179 GATCGCGAGCGCGATCGGGATCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 685814-687493	Sequence	BBK_561 - nitrite and sulphite reductase 4Fe-4S domain protein (Protein is coded in complementary strand; from 687493 to 685814)