Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 56085
End position: 56111
Length: 27

DNA sequence
>NC_022659, from 56085 to 56111 (27 bp); Burkholderia pseudomallei NCTC 13179 TGCTTGTCGTGCTTGTCGTGCTTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 55196-57454	Sequence	BBK_45 - branched-chain amino acid transport system / permease component family protein (Protein is coded in complementary strand; from 57454 to 55196)