Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 492998
End position: 493027
Length: 30

DNA sequence
>NC_022659, from 492998 to 493027 (30 bp); Burkholderia pseudomallei NCTC 13179 CCACACGTCAGCACTCGTCAGCACTCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 493026-494240	Sequence	BBK_404 purT purT: phosphoribosylglycinamide formyltransferase 2 (Protein is coded in complementary strand; from 494240 to 493026)