Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 431437
End position: 431472
Length: 36

DNA sequence
>NC_022659, from 431437 to 431472 (36 bp); Burkholderia pseudomallei NCTC 13179 CGCCGTCCACACCGTCCACGCCGGCCACGCCGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 430167-431447	Sequence	BBK_350 - sugar (and other) transporter family protein (Protein is coded in complementary strand; from 431447 to 430167)