Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3864810
End position: 3864833
Length: 24

DNA sequence
>NC_022659, from 3864810 to 3864833 (24 bp); Burkholderia pseudomallei NCTC 13179 CGAGCGCGCGCGCGAACGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3864551-3865444	Sequence	BBK_3329 cysT sulfate ABC transporter, permease protein CysT (Protein is coded in complementary strand; from 3865444 to 3864551)