Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3863051
End position: 3863074
Length: 24

DNA sequence
>NC_022659, from 3863051 to 3863074 (24 bp); Burkholderia pseudomallei NCTC 13179 GCGAGCGCGCGCGCGAGCGCGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3862451-3863506	Sequence	BBK_3327 cysA sulfate ABC transporter, ATP-binding family protein (Protein is coded in complementary strand; from 3863506 to 3862451)