Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3832037
End position: 3832063
Length: 27

DNA sequence
>NC_022659, from 3832037 to 3832063 (27 bp); Burkholderia pseudomallei NCTC 13179 GCCGCATTTGCCGCATTTGCCGCATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3831902-3832870	Sequence	BBK_3302 - TPR repeat family protein (Protein is coded in complementary strand; from 3832870 to 3831902)