Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3830638
End position: 3830673
Length: 36

DNA sequence
>NC_022659, from 3830638 to 3830673 (36 bp); Burkholderia pseudomallei NCTC 13179 GGCGACCGGCACGACGACCGTCACGCCGACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3830453-3831433	Sequence	BBK_3300 - tadE-like family protein (Protein is coded in complementary strand; from 3831433 to 3830453)