Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3808588
End position: 3808611
Length: 24

DNA sequence
>NC_022659, from 3808588 to 3808611 (24 bp); Burkholderia pseudomallei NCTC 13179 CGCGCGCTCGCGCGCGCACGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3808523-3810124	Sequence	BBK_3285 - asparagine synthase family protein