Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3784878
End position: 3784904
Length: 27

DNA sequence
>NC_022659, from 3784878 to 3784904 (27 bp); Burkholderia pseudomallei NCTC 13179 CGGCCGCCTCGGTCGCCTCGGTCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3776957-3786859	Sequence	BBK_3265 dltA D-ala-DACP-lig: D-alanine--poly(phosphoribitol) ligase, subunit 1 (Protein is coded in complementary strand; from 3786859 to 3776957)