Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3318801
End position: 3318824
Length: 24

DNA sequence
>NC_022659, from 3318801 to 3318824 (24 bp); Burkholderia pseudomallei NCTC 13179 CGCGCCCGCACCCGCGCCCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3318370-3319479	Sequence	BBK_2888 hdaH histone deacetylase-like amidohydrolase (Protein is coded in complementary strand; from 3319479 to 3318370)