Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3297703
End position: 3297765
Length: 63

DNA sequence
>NC_022659, from 3297703 to 3297765 (63 bp); Burkholderia pseudomallei NCTC 13179 AACCACCAACCACCAACCACCAACCACCAACCACCAACTACCAACTACCAACCACCAACTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3297762-3301235	Sequence	BBK_2867 mfd mfd: transcription-repair coupling factor (Protein is coded in complementary strand; from 3301235 to 3297762)