Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3190242
End position: 3190268
Length: 27

DNA sequence
>NC_022659, from 3190242 to 3190268 (27 bp); Burkholderia pseudomallei NCTC 13179 CGGCGTCGCAGGCGTCGCCGGCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3188807-3190357	Sequence	BBK_2777 - helicase conserved C-terminal domain protein (Protein is coded in complementary strand; from 3190357 to 3188807)