Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 3118901
End position: 3118942
Length: 42

DNA sequence
>NC_022659, from 3118901 to 3118942 (42 bp); Burkholderia pseudomallei NCTC 13179 CCGCGGCTAGTCGTCCGTGGCTAATCGTCCGTGGCTAATCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3118936-3120156	Sequence	BBK_2724 - hypothetical protein (Protein is coded in complementary strand; from 3120156 to 3118936)