Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 306692
End position: 306721
Length: 30

DNA sequence
>NC_022659, from 306692 to 306721 (30 bp); Burkholderia pseudomallei NCTC 13179 CGGCGCGCGCCCGCGCGAGCCCGCGCGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 304398-308189	Sequence	BBK_245 recB recB: exodeoxyribonuclease V, beta subunit (Protein is coded in complementary strand; from 308189 to 304398)