Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 293729
End position: 293773
Length: 45

DNA sequence
>NC_022659, from 293729 to 293773 (45 bp); Burkholderia pseudomallei NCTC 13179 CATCCGGTCCTTCGACATCGCATCCTTCGACATCGCGTCTTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 293619-293924	Sequence	BBK_236 - pentapeptide MXKDX repeat family protein (Protein is coded in complementary strand; from 293924 to 293619)