Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 2916659
End position: 2916682
Length: 24

DNA sequence
>NC_022659, from 2916659 to 2916682 (24 bp); Burkholderia pseudomallei NCTC 13179 GCGTCGTCGTCGGTGTCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2916341-2917351	Sequence	BBK_2556 - luciferase oxidoreductase, group 1 family protein (Protein is coded in complementary strand; from 2917351 to 2916341)