Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 2863716
End position: 2863745
Length: 30

DNA sequence
>NC_022659, from 2863716 to 2863745 (30 bp); Burkholderia pseudomallei NCTC 13179 GCGGCTCGCGCCGGTTCGCGTCAGCTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2863737-2864459	Sequence	BBK_2506 - tetrapyrrole (Corrin/Porphyrin) Methylases family protein (Protein is coded in complementary strand; from 2864459 to 2863737)