Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 2686102
End position: 2686125
Length: 24

DNA sequence
>NC_022659, from 2686102 to 2686125 (24 bp); Burkholderia pseudomallei NCTC 13179 CGCCCGCGCTCGCGCCCGCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2686041-2687966	Sequence	BBK_2338 glk glk: glucokinase (Protein is coded in complementary strand; from 2687966 to 2686041)