Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 2673293
End position: 2673337
Length: 45

DNA sequence
>NC_022659, from 2673293 to 2673337 (45 bp); Burkholderia pseudomallei NCTC 13179 TCTTCGTCTTCGTCGTCCTCGTCTTCCTCGTCCTCTTCGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2673281-2673802	Sequence	BBK_2325 ribH lumazine-synth: 6,7-dimethyl-8-ribityllumazine synthase (Protein is coded in complementary strand; from 2673802 to 2673281)