Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 2532395
End position: 2532421
Length: 27

DNA sequence
>NC_022659, from 2532395 to 2532421 (27 bp); Burkholderia pseudomallei NCTC 13179 TGCGCGCGGTGCGGGCGGTGCGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2530076-2532439	Sequence	BBK_2206 xdhB xanthine dehydrogenase, molybdopterin binding subunit