Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 2478194
End position: 2478218
Length: 25

DNA sequence
>NC_022659, from 2478194 to 2478218 (25 bp); Burkholderia pseudomallei NCTC 13179 CGCGTCGCGGCTCGTCGTGTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2477905-2480145	Sequence	BBK_2154 - exopolysaccharide transport family protein