Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 2365382
End position: 2365408
Length: 27

DNA sequence
>NC_022659, from 2365382 to 2365408 (27 bp); Burkholderia pseudomallei NCTC 13179 GCTCAAGCTGCTCGAGCTGCTCAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2364997-2365956	Sequence	BBK_2061 - bacterial regulatory helix-turn-helix , lysR family protein