Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 2053429
End position: 2053452
Length: 24

DNA sequence
>NC_022659, from 2053429 to 2053452 (24 bp); Burkholderia pseudomallei NCTC 13179 GACGACGATGACGAGGACGAAGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2052731-2055004	Sequence	BBK_1782 - type IV secretion-system coupling DNA-binding domain protein