Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 1741215
End position: 1741241
Length: 27

DNA sequence
>NC_022659, from 1741215 to 1741241 (27 bp); Burkholderia pseudomallei NCTC 13179 CCGAATCCGCTGAATCCGGCGAATCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1741211-1741852	Sequence	BBK_1484 - transcriptional regulator PadR-like family protein (Protein is coded in complementary strand; from 1741852 to 1741211)