Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 1517595
End position: 1517619
Length: 25

DNA sequence
>NC_022659, from 1517595 to 1517619 (25 bp); Burkholderia pseudomallei NCTC 13179 CGCCACGCCACGTCACGTCACGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1517618-1518388	Sequence	BBK_1280 xth exodeoxyribonuclease III (Protein is coded in complementary strand; from 1518388 to 1517618)