Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 1403097
End position: 1403123
Length: 27

DNA sequence
>NC_022659, from 1403097 to 1403123 (27 bp); Burkholderia pseudomallei NCTC 13179 CGTGCGCGTCGCGCGCGTCGTGCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1402931-1404607	Sequence	BBK_1169 - natural resistance-associated macrophage family protein (Protein is coded in complementary strand; from 1404607 to 1402931)