Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 1262327
End position: 1262350
Length: 24

DNA sequence
>NC_022659, from 1262327 to 1262350 (24 bp); Burkholderia pseudomallei NCTC 13179 GGGGTGACGGGGTGACGGGGTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1261432-1262334	Sequence	BBK_1045 - bacterial regulatory helix-turn-helix , lysR family protein