Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 1197731
End position: 1197754
Length: 24

DNA sequence
>NC_022659, from 1197731 to 1197754 (24 bp); Burkholderia pseudomallei NCTC 13179 CCGCGCCCGCGCTCGCGCGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1196579-1197931	Sequence	BBK_986 - dat: 2,4-diaminobutyrate 4-transaminase family protein