Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 1122538
End position: 1122561
Length: 24

DNA sequence
>NC_022659, from 1122538 to 1122561 (24 bp); Burkholderia pseudomallei NCTC 13179 TCGTCGTCGTCCGCGTCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1122271-1124280	Sequence	BBK_920 - trkA-N domain protein (Protein is coded in complementary strand; from 1124280 to 1122271)