Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 1112652
End position: 1112675
Length: 24

DNA sequence
>NC_022659, from 1112652 to 1112675 (24 bp); Burkholderia pseudomallei NCTC 13179 CGCCGCCACCGCCGCCGCCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1112588-1113145	Sequence	BBK_912 ssb single-stranded DNA-binding protein (Protein is coded in complementary strand; from 1113145 to 1112588)